XRNA Examples

• How do I build e.coli_5S from scratch?
• Is there a description of the xrna xml format?
• How can I create a multi-strand xrna figure from old style XRNA postscript (*.ps) file?
• How do I build group I intron from old style XRNA postscript (*.ps) file?
• How do I build group I intron from scratch?

How do I build e.coli_5S from scratch?

• See How do I format from scratch?
• Enter the following primary sequence using cut and paste or entering by text file:
  UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAU
  GCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGU
  GUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU
  
• Create a text file out of the following helix information and read in, or enter one at a time:
  1 119 10
  16 68 2
  18 65 6
  28 56 3
  31 51 4
  70 106 5
  79 97 8
  
• Press the button labeled "Run Format"
• Try setting the text fields 5'X, 5'Y, 3'X, and 3'Y to -10.0, 10.0, 10.0, -10.0 respectively and re-press "Run Format."
• Go to the "Edit" panel and finish editing.

How can I create a multi-strand xrna figure from old style XRNA postscript (*.ps) file?

• Download u1u2_ref_u6u4_homsap.ps into a suitable work area and read into XRNA. This layout and basepair information is from the Manny Ares lab, UCSC. At this point the structure is one rna strand without any basepairing. Print out or somehow view the postscript in u1u2_ref_u6u4_homsap.ps for reference for the base pairs.
• Do an initial write out of a XRNA input file by using the "Import/Export" tab and the "Write XRNA I/O file" button. The file name will be initialized to the prefix name of the "*.ps" file but with a ".xrna" extension. Change the prefix name if desired. From now on selecting the "Update XRNA I/O file" button in the "Main Controls:" panel will update this new XRNA input file.
• In the "Edit" panel, using the "list nucs" constraint mode, pick and name the rna strands U1,U2,U4 and U6 by doing the following:
  • Using "list nucs" and the right mouse button first pick nuc 446 then nuc 609 and name the grouping U1 by filling in the text field next to the button labeled "Add to Group named:" and either pressing the button or typing the return key.
  • For U2 select nucs 252 then 438 and name the grouping U2_0
  • select nucs 439 through 445 and add to the grouping named U2_1
  • select nucs 1 through 106 and add to group named U6
  • select nucs 107 through 251 and add to group named U4
• Use the "Update XRNA I/O File" button to update work so far
• In the "Edit" panel using the "rna named group" constraint mode select each of the named groups U1, U2_0, U2_1, U6, and U4 and make into a unique rna strand by selecting the button labeled "Change to rna strand." This will make a rna strand with the same name as the grouping name.
• Use the "Update XRNA I/O File" button to update work so far
• In the "Format" panel select the "Format Helix" button and start to make all helices like in u1u2_ref_u6u4_homsap.ps. Make sure to first de-select the "Format hairpin" radio button.

How do I build group I intron from old style XRNA postscript (*.ps) file?

• Download group_I_intron.ps into a suitable work area and read into XRNA. The group_I_intron layout and basepair information is from The T.R. Cech lab, University of Colorado, Boulder.
• Do an initial write out of a XRNA input file by using the "Import/Export" tab and the "Write XRNA I/O file" button. The file name will be initialized to the prefix name of the "*.ps" file but with a ".xrna" extension. Change the prefix name if desired. From now on selecting the "Update XRNA I/O file" button in the "Main Controls:" panel will update this new XRNA input file.
• Go to the "Edit" panel and edit or delete any labels that were derived from the group_I_intron.ps file. Currently only text type labels are mapped. These labels will be mapped to the "rna strand" and not to the rna strand grouping that the rna strand is in nor the overall scene. When adding new labels to the figure, make sure to select the current strand to be adding to. See What is the "Pick Strand" button in the "Main Controls:" panel for?, and How do I add extraneous labels? Use the "Update XRNA I/O file" button often.
• Since the initial structure will not contain any base pair information, all helices must be created in place. Go to the "Format" panel and select the "Format Helix" button. See the XRNA Faq question How do I format a new helix to format all helices in place for the group_I_intron secondary structure graph. Make sure not to reformat helix hairpin loops, during this stage, by de-selecting the "Format HairPin" radio button. This is to prevent a hairpin loop being created out of areas not anticipated. Wait until all helices are created and it is obvious where the single stranded loops are to clean up. Use the "Update XRNA I/O file" button often.
• Go to the "Edit" panel and start cleaning up structure.
  • Select the "rna helix" constraint mode
  • Make sure all helices are at right angles (0, 90, 180, or 270 degrees) by right mouse clicking on a helix and setting the angle.
  • Readjust hairpins and other single stranded regions (see How do I edit stuff according to constraints?).
  • Make sure that layout of areas is in line by using the horizontal and vertical grids on the left hand menu panel of the "Edit" panel.
  • Add nucleotide labels (see How do I add/delete nucleotide labels? and How do I edit nucleotide labels or any other extraneous label?). Select the "rna strand" constraint mode. Right mouse click on any nucleotide in the figure. Make sure that labeling starts at nucleotide number 6 as the group I intron appears to be made up of more than one strand.
• Go to the "Annotate" panel and add extraneous labels (see How do I add extraneous labels?>

How do I build group_I_intron from scratch?

• See How do I format from scratch?
• Enter the following primary sequence using cut and paste or entering by text file:
  UAAAUAGCAAUAUUUACCUUUGGAGGGAAAAGUUAUCAGG
  CAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAU
  CGGUUUAAAAGGCAAGACCGUCAAAUUGCGGGAAAGGGGU
  CAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAG
  AUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUG
  GUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUC
  UGUUGAUAUGGAUGCAGUUCACAGACUAAAUGUCGGUCGG
  GGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUC
  CUUAAUGGGAGCUAGCGGAUGAAGUGAUGCAACACUGGAG
  CCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAG
  UUUUGGAGUACUCGUAAGGUAGCCAA
  
• Create a text file out of the following helix information and read in, or enter one at a time (note that the helix represented by "96 278 8" is commented out since this will introduce a pseudo knot;any pseudo knot must be dealt with separate from this step):
  1 22 4
  31 56 10
  58 93 4
  62 88 10
  #96 278 7
  107 214 6
  117 204 3
  126 196 4
  131 192 4
  135 187 1
  136 182 3
  139 154 1
  165 175 3
  215 258 3
  220 253 4
  227 247 8
  262 312 1
  264 311 5
  279 299 8
  313 413 2
  318 331 5
  332 367 7
  343 356 4
  369 402 15
  
• Press the button labeled "Run Format."
• Enter a new name into the "prefix name" text field (make sure to press the return key or click the button next to the text field for the new prefix name to be applied).
• Go to the "Import/Export" tab to do an initial write out of file by selecting the "Write XRNA I/O file" button and pressing "Save".
• Go to the "Edit" tab and get into "RNA Cycle" edit mode, right mouse click on nuc 25 (or any nuc in the level 0 cycle) and press the button entitled "Hide connecting single strands."
• Press the button labeled "Update XRNA I/O file" in the "Main Controls" panel.
• Get into "rna sub-domain" constraint mode, set the "left mouse edit" radio button on the left hand panel to on, and move sub-domains around and rotate so they can be dealt with easily. The figure should currently look something like this.
• Start identifying collections of nucleotides to move around together by using the "Annotate" panel and various constraint modes to uniquely color nucleotides. Choose arbitrary but constrasting colors. Avoid using green as this is a color used often while editing. Once uniquely colored then a collection of similarly colored nucleotides can be edited together in the "Edit" panel using the "rna color unit" constraint mode. For the group_I_intron example try the following groupings:
  • Select an arbitrary color
  • Use the "Find" button in the "Main Controls" panel to find nuc 313
  • Set the constraint mode to "rna sub-domain"
  • Right mouse click on nuc 313 and "Set to current color."
  • Find the sub-domain that starts with nuc 262 and set to the same color
  • Select a different arbitrary color and color sub-domains at nuc 1, 31, and 58.
  • Select a different arbitrary color and color sub-domains at nuc 126, and 58.
  The current figure should look something like this.
• Go to the "Edit" panel, set the constraint mode to "single strand" right mouse click on the single strand containing nuc 200 and set its "Hidden" attribute. Same sith single strand containing 123. Check the current figure for results of this operation. This will allow for less messier editing of this area.
• Move the P9 area to the upper right corner by using the "rna sub-domain" constraint mode and picking the first helix (helix starting at nuc 313) with the left mouse button. Right mouse edit to set the angle to 90.0. Use the "Center scene at origin" button whenever things don't seem centered. Hide single stranded regions in this sub-domain by right mouse editing in "rna cycle" constraint mode and using the button entitled "Hide connecting single strands." Rotate stacked helices to desired positions by right mouse editing in "rna stacked helix" constraint mode.